Journal: bioRxiv

Article Title: A Yeast Two-Hybrid Protein Domain Screening Approach for Ebola Virus-Human Protein Interactions Identifies PABPC1 as a Host Factor Required for Replication

doi: 10.64898/2026.03.05.709814

Figure Lengend Snippet: Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Article Snippet: Unidirectional cDNA was prepared from 1 μg of total RNA using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina following the “Protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490)” through step 1.7 (Manual Version 5.0 5/15) with the following changes: 1) poly(A)+ mRNA was eluted for 5 minutes at 65 °C to prevent fragmentation; 2) after synthesizing second strand cDNA, the cDNA was purified using a Zymo Research DNA Clean & Concentrator-5 column (#D4013); 3) the adaptor primer (/5Phos/GATCGGAAGAGCTTGTTCTACCGAGGGACCC/ideoxyU/ ACTACTGCCTAAC GAACTCCCGCTCTTCCGATC*T; * indicates a phosphorothioate bond; synthesized and PAGE purified by IDT) was a modification of the NEBNext Adaptor for Illumina (E7352A).

Techniques: Inhibition, Expressing, Transfection, Negative Control, Infection, Staining, Isolation, Quantitative RT-PCR, SDS Page, Western Blot, Molecular Weight

Journal: American Journal of Cancer Research

Article Title: Immune response evoked by tumor-associated NADH oxidase (tNOX) confers potential inhibitory effect on lung carcinoma in a mouse model

doi:

Figure Lengend Snippet: The protein expression and immune responses of the human tNOX recombinant proteins in mice. Recombinant human tNOX was expressed in E. coli and purified with His-tag purification resin. A. The expressed, purified and dialyzed proteins were resolved by SDS-PAGE and detected by western blot analysis with anti-His tag and anti-tNOX antibodies, and are shown in Lanes 1, 2 and 3, respectively. The molecular weight (KDa) marker (M) is shown at the left. Arrow indicates the tNOX protein band. B. Blood samples were collected at 0, 14, 28 and 35 days after the first vaccination and antibody titers were measured by ELISA. The specific anti-tNOX antibody response was significantly higher in the tNOX vaccine group compared with unvaccinated controls (*P < 0.05). C. Splenocytes of mice were stimulated with human tNOX protein and IFN-γ-secreting T cells were evaluated by ELISpot assay. Representative images show proliferative spots of splenocytes from mice vaccinated with tNOX (tNOX) or without tNOX (NC). D. The frequencies of tNOX-specific IFN-γ-secreting T cells was significantly higher in the tNOX vaccine group compared to the NC group (*P < 0.05). The average spot counts of the NC and tNOX vaccine groups were 67 ± 13 and 155 ± 42, respectively.

Article Snippet: ELISpot assays were performed using a Mouse IFN-γ ELISpot Development Module (R&D Systems, Inc., Minneapolis, MN, USA) according to the manufacturer’s protocol.

Techniques: Expressing, Recombinant, Purification, SDS Page, Western Blot, Molecular Weight, Marker, Enzyme-linked Immunosorbent Assay, Enzyme-linked Immunospot